ABSTRACT
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
ABSTRACT
We reported a case of monochorionic monoamniotic twins discordant for anencephaly diagnosed by second-trimester ultrasonography at the First Affiliated Hospital of Fujian Medical University.Ultrasound at seven weeks of gestation showed only one gestational sac with an embryo inside.Another 12 gestational weeks' ultrasound scan performed at another hospital found one gestational sac and one fetus (crown-rump length was 6.11 cm and nuchal translucency was 0.11 cm) in the upper-middle uterine cavity.The ultrasound examination at 22+6 gestational weeks identified one placenta and two fetuses without obvious diaphragm echo in between.Although no structural abnormality was observed in one fetus,frog-like eyes,absence of skull image and brain tissue echo were presented in the other fetus.The patient was transferred to a higher level hospital and was successfully performed radiofrequency ablation for selective reduction at 23+4 weeks of gestation.At 35 weeks,a premature live boy and an anencephalic stillbirth fetus were born vaginally after premature rupture of membranes.The baby boy was healthy at follow-up at four months old.
ABSTRACT
Objective To quantitatively observe the value of relationship between nodule and corresponding capsular with ultrasonography in assessment of malignant and benign thyroid nodules.Methods A total of 79 cases with subcapsular tumors of thyroid gland confirmed pathologically were analyzed retrospectively,and the relationship between tumors and capsule was analyzed.Longitudinal diameter of nodules (from the junction of nodule and capsule to the deepest of nodule,V) and distance from nodule protruding thyroid capsule to the highest point of nodule (L) were measured,and L/V was evaluated.Diagnostic efficiency of L/V in diagnosis of malignant thyroid nodule was evaluated.Results The average L/V of benign and malignant nodules was 0.241± 0.041 and 0.162± 0.054,respectively (t=-7.367,P<0.01).The area under ROC curve of L/V in diagnosis of benign and malignant thyroid nodules was 0.87 (P<0.01).When L/V=0.225,the sensitivity was 82.17%,and the specificity was 87.53%;when L/V=0.245,the sensitivity was 67.10 %,and the specificity was 95.12%.Conclusion Ultrasonography can clearly show the relationship between thyroid nodules and capsule,and L/V can be used for differential diagnosis of benign and malignant thyroid nodules.